Missing content? – Request curation!
Request curation for specific Genes, Variants, or PubMed publications.
Have questions, comments, or suggestions? - Let us know!
Email us at : ckbsupport@genomenon.com
Gene | TP53 |
Variant | D324Afs*32 |
Impact List | frameshift |
Protein Effect | loss of function - predicted |
Gene Variant Descriptions | TP53 D324Afs*32 indicates a shift in the reading frame starting at amino acid 324 and terminating 32 residues downstream causing a premature truncation of the 393 amino acid Tp53 protein (UniProt.org). D324Afs*32 has not been biochemically characterized however, due to the effects of truncation mutations downstream of D324 (PMID: 31081129, PMID: 34045312), is predicted to lead to a loss of Tp53 protein function. |
Associated Drug Resistance | |
Category Variants Paths |
TP53 mutant TP53 exon9 TP53 D324Afs*32 TP53 mutant TP53 inact mut TP53 D324Afs*32 |
Transcript | NM_000546.6 |
gDNA | chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG |
cDNA | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA |
Protein | p.D324Afs*32 |
Source Database | RefSeq |
Genome Build | GRCh38/hg38 |
Transcript | gDNA | cDNA | Protein | Source Database | Genome Build |
---|---|---|---|---|---|
NM_000546.6 | chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_001407262.1 | chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_001407270.1 | chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_001407268.1 | chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_001407266.1 | chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_001126113.3 | chr17:g.7673557_7673558insTTGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_000546 | chr17:g.7673559_7673590dupCAGTGGTTTCTTCTTTGGCTGGGGAGAGGAGC | c.939_970dup | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_001126114.3 | chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_001407264.1 | chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
NM_001126112.3 | chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG | c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA | p.D324Afs*32 | RefSeq | GRCh38/hg38 |
Molecular Profile | Protein Effect | Treatment Approaches |
---|---|---|
TP53 D324Afs*32 | loss of function - predicted | p53 Gene Therapy |