TP53 D324Afs*32
Gene Variant Detail

Contact

Missing content? – Request curation!

Request curation for specific Genes, Variants, or PubMed publications.

Have questions, comments, or suggestions? - Let us know!

Email us at : ckbsupport@genomenon.com

Gene TP53
Variant D324Afs*32
Impact List frameshift
Protein Effect loss of function - predicted
Gene Variant Descriptions TP53 D324Afs*32 indicates a shift in the reading frame starting at amino acid 324 and terminating 32 residues downstream causing a premature truncation of the 393 amino acid Tp53 protein (UniProt.org). D324Afs*32 has not been biochemically characterized however, due to the effects of other truncation mutations downstream of D324 (PMID: 31081129PMID: 34045312), is predicted to lead to a loss of Tp53 protein function.
Associated Drug Resistance
Category Variants Paths

TP53 mutant TP53 exon9 TP53 D324Afs*32

TP53 mutant TP53 inact mut TP53 D324Afs*32

Filtering

  • Case insensitive filtering will display rows if any text in any cell matches the filter term
  • Use simple literal full or partial string matches
  • Separate multiple filter terms with a space. Any order may be used (i. e. a b c and c b a are equivalent )
  • Filtering will only apply to rows that are already loaded on the page. Filtering has no impact on query parameters.
  • Use quotes to match on a longer phrase with spaces (i.e. "mtor c1483f")

Sorting

  • Generally, the default sort order for tables is set to be first column ascending; however, specific tables may set a different default sort order.
  • Click on any column header arrows to sort by that column
  • Hold down the Shift key and click multiple columns to sort by more than one column. Be sure to set ascending or descending order for a given column before moving on to the next column.

Transcript NM_000546.6
gDNA chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG
cDNA c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA
Protein p.D324Afs*32
Source Database RefSeq
Genome Build GRCh38/hg38
Transcript gDNA cDNA Protein Source Database Genome Build
NM_001126113.3 chr17:g.7673557_7673558insTTGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001126114.3 chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001126112.3 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407262.1 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_000546 chr17:g.7673559_7673590dupCAGTGGTTTCTTCTTTGGCTGGGGAGAGGAGC c.939_970dup p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407264.1 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407268.1 chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407266.1 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407270.1 chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_000546.6 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38

Filtering

  • Case insensitive filtering will display rows if any text in any cell matches the filter term
  • Use simple literal full or partial string matches
  • Separate multiple filter terms with a space. Any order may be used (i. e. a b c and c b a are equivalent )
  • Filtering will only apply to rows that are already loaded on the page. Filtering has no impact on query parameters.
  • Use quotes to match on a longer phrase with spaces (i.e. "mtor c1483f")

Sorting

  • Generally, the default sort order for tables is set to be first column ascending; however, specific tables may set a different default sort order.
  • Click on any column header arrows to sort by that column
  • Hold down the Shift key and click multiple columns to sort by more than one column. Be sure to set ascending or descending order for a given column before moving on to the next column.

Molecular Profile Indication/Tumor Type Response Type Therapy Name Approval Status Evidence Type Efficacy Evidence References