TP53 D324Afs*32
Gene Variant Detail

Contact

Missing content? – Request curation!

Request curation for specific Genes, Variants, or PubMed publications.

Have questions, comments, or suggestions? - Let us know!

Email us at : ckbsupport@genomenon.com

Gene TP53
Variant D324Afs*32
Impact List frameshift
Protein Effect loss of function - predicted
Gene Variant Descriptions TP53 D324Afs*32 indicates a shift in the reading frame starting at amino acid 324 and terminating 32 residues downstream causing a premature truncation of the 393 amino acid Tp53 protein (UniProt.org). D324Afs*32 has not been biochemically characterized however, due to the effects of other truncation mutations downstream of D324 (PMID: 31081129PMID: 34045312), is predicted to lead to a loss of Tp53 protein function.
Associated Drug Resistance
Category Variants Paths

TP53 mutant TP53 exon9 TP53 D324Afs*32

TP53 mutant TP53 inact mut TP53 D324Afs*32

Filtering

  • Case insensitive filtering will display rows if any text in any cell matches the filter term
  • Use simple literal full or partial string matches
  • Separate multiple filter terms with a space. Any order may be used (i. e. a b c and c b a are equivalent )
  • Filtering will only apply to rows that are already loaded on the page. Filtering has no impact on query parameters.
  • Use quotes to match on a longer phrase with spaces (i.e. "mtor c1483f")

Sorting

  • Generally, the default sort order for tables is set to be first column ascending; however, specific tables may set a different default sort order.
  • Click on any column header arrows to sort by that column
  • Hold down the Shift key and click multiple columns to sort by more than one column. Be sure to set ascending or descending order for a given column before moving on to the next column.

Transcript NM_000546.6
gDNA chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG
cDNA c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA
Protein p.D324Afs*32
Source Database RefSeq
Genome Build GRCh38/hg38
Transcript gDNA cDNA Protein Source Database Genome Build
NM_001126114.3 chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407266.1 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407268.1 chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001126112.3 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_000546 chr17:g.7673559_7673590dupCAGTGGTTTCTTCTTTGGCTGGGGAGAGGAGC c.939_970dup p.D324Afs*32 RefSeq GRCh38/hg38
NM_001126113.3 chr17:g.7673557_7673558insTTGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407264.1 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_000546.6 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407270.1 chr17:g.7673557_7673558insTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAA p.D324Afs*32 RefSeq GRCh38/hg38
NM_001407262.1 chr17:g.7673557_7673558insTTTTGGGGGGGGGGGGGGGGGGGGGGGGGGGG c.970_971insCCCCCCCCCCCCCCCCCCCCCCCCCCCCAAAA p.D324Afs*32 RefSeq GRCh38/hg38

Filtering

  • Case insensitive filtering will display rows if any text in any cell matches the filter term
  • Use simple literal full or partial string matches
  • Separate multiple filter terms with a space. Any order may be used (i. e. a b c and c b a are equivalent )
  • Filtering will only apply to rows that are already loaded on the page. Filtering has no impact on query parameters.
  • Use quotes to match on a longer phrase with spaces (i.e. "mtor c1483f")

Sorting

  • Generally, the default sort order for tables is set to be first column ascending; however, specific tables may set a different default sort order.
  • Click on any column header arrows to sort by that column
  • Hold down the Shift key and click multiple columns to sort by more than one column. Be sure to set ascending or descending order for a given column before moving on to the next column.

Molecular Profile Indication/Tumor Type Response Type Therapy Name Approval Status Evidence Type Efficacy Evidence References
TP53 mutant glioblastoma sensitive Adavosertib Preclinical - Pdx Actionable In a preclinical study, treatment with Adavosertib (MK-1775) decreased CDK1 phosphorylation and reduced tumor growth in patient-derived xenograft models of glioblastoma multiforme that harbor TP53 mutations (PMID: 27196784). 27196784
TP53 mutant lung non-small cell carcinoma predicted - sensitive Pembrolizumab Clinical Study - Cohort Actionable In a clinical study, a retrospective analysis of a Phase I trial demonstrated non-small cell lung carcinoma (NSCLC) patients harboring either a TP53 mutation (n=15) or KRAS mutation (n=8) had greater progression free survival compared to NSCLC patients harboring wild-type TP53 or KRAS (n=15) (14.5mo vs 14.7mo vs 3.5mo, respectively) when treated with Keytruda (pembrolizumab) (PMID: 28039262). 28039262
TP53 mutant lung non-small cell carcinoma predicted - sensitive Pembrolizumab Clinical Study - Cohort Actionable In a clinical study, immune checkpoint inhibitor treatment including Keytruda (pembrolizumab) (n=1), Opdivo (nivolumab) with (n=8) or without (n=63) Yervoy (ipilimumab) resulted in improved median overall survival (18.1 vs 8.1 months, HR=0.48, p=0.04), median progression-free survival (4.5 vs 1.4 months, p=0.03), and objective response rate (51.2% vs 20.7%, p=0.01) in TP53 mutant (n=41) non-small cell lung cancer patients compared to TP53 wild-type (n=31) patients (PMID: 31097096). 31097096
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Obinutuzumab + Venetoclax Guideline Actionable The combination of Venclexta (venetoclax) and Gazyva (obinutuzumab) is included in guidelines as first-line therapy for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant neuroblastoma resistant GSK2830371 Preclinical Actionable In a preclinical study, neuroblastoma cell lines harboring TP53 mutations were resistant to GSK2830371 induced growth inhibition in culture (PMID: 25658463). 25658463
TP53 mutant colorectal cancer sensitive PD0166285 Preclinical Actionable In a preclinical study, PD0166285 sensitizes colorectal cancer cells with TP53 mutation to radiation induced cell death (PMID: 11719452). 11719452
TP53 mutant triple-receptor negative breast cancer predicted - sensitive Carboplatin + Nutlin-3a Preclinical - Cell culture Actionable In a preclinical study, Nutlin-3 and Paraplatin (carboplatin) synergistically inhibited growth in TP53 mutated triple-receptor negative breast cancer cell lines in culture and in cell line xenograft models (PMID: 26494859). 26494859
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Duvelisib Guideline Actionable Copiktra (duvelisib) is included in guidelines for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 mutant high grade glioma predicted - sensitive KU-60019 + Radiotherapy Preclinical Actionable In a preclinical study, KU-60019 treatment increased sensitivity to radiotherapy in TP53-mutant mouse glioma cells in culture, and the combination prolonged survival in syngeneic intracranial tumor models compared to radiation alone (PMID: 29769307). 29769307
TP53 mutant chronic lymphocytic leukemia sensitive Acalabrutinib Guideline Actionable Calquence (acalabrutinib) is included in guidelines as preferred first-line therapy for patients with advanced chronic lymphocytic leukemia harboring TP53 mutations and for patients with relapsed or refractory disease (PMID: 38969011; ESMO.org). 38969011 detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Acalabrutinib + Obinutuzumab + Venetoclax Guideline Actionable The combination of Venclexta (venetoclax), Gazyva (obinutuzumab), and Calquence (acalabrutinib) is included in guidelines as first-line therapy for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Lenalidomide + Rituximab Guideline Actionable Revlimid (lenalidomide) combined with Rituxan (rituximab) is included in guidelines for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 mutant myelodysplastic syndrome not applicable N/A Guideline Prognostic TP53 mutations except P47S and P72R are associated with a poor prognosis in patients with myelodysplastic syndrome (NCCN.org). detail...
TP53 mutant tongue squamous cell carcinoma sensitive Ceralasertib + Radiotherapy Preclinical - Cell culture Actionable In a preclinical study, AZD6738 treatment increased sensitivity to radiotherapy in a tongue squamous cell carcinoma cell line harboring a TP53 mutation in culture, resulting in a greater decrease in cell survival compared to radiation treatment alone (PMID: 28062704). 28062704
TP53 mutant hypopharynx cancer predicted - sensitive unspecified EGFR antibody + unspecified IGF-1R antibody Preclinical - Cell culture Actionable In a preclinical study, combination of an unspecified EGFR antibody and an unspecified Igf-1r antibody resulted in inhibition of survival in TP53 mutated hypopharyngeal carcinoma cancer cells that developed Erbitux (cetuximab) resistance in culture (PMID: 27196767). 27196767
TP53 mutant high grade glioma predicted - sensitive AZ32 + Radiotherapy Preclinical Actionable In a preclinical study, AZ32 treatment increased sensitivity to radiotherapy in TP53 mutant mouse glioma cells, resulting in reduced cell survival and impaired DNA damage response in culture, and prolonged survival and significantly increased apoptosis of tumor cells compared to normal brain cells (p<0.01) in syngeneic intracranial tumor models (PMID: 29769307). 29769307
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Pirtobrutinib Guideline Actionable Jaypirca (pirtobrutinib) is included in guidelines (category 1) as second-line or subsequent therapy for patients with chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation and for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 mutant ovarian clear cell adenocarcinoma decreased response DS-7423 Preclinical Actionable In a preclinical study, ovarian clear cell adenocarcinoma cell lines harboring TP53 mutations demonstrated reduced sensitivity to DS-7423 induced apoptosis in culture compared to TP53 wild-type cells (PMID: 24504419). 24504419
TP53 mutant mantle cell lymphoma not applicable N/A Guideline Prognostic TP53 mutations are associated with poor prognosis in patients with mantle cell lymphoma who are treated with conventional therapy, including transplant (NCCN.org). detail...
TP53 mutant lung non-small cell carcinoma not predictive Osimertinib Clinical Study - Cohort Actionable In a retrospective analysis, patients with non-small cell lung cancer harboring TP53 mutations at treatment discontinuation of Tagrisso (osimertinib) had shorter time to treatment discontinuation (6.5 vs 11.5 months, p=0.0029) compared to patients with wild-type TP53 (PMID: 31839416). 31839416
TP53 mutant Advanced Solid Tumor sensitive Bevacizumab Clinical Study - Cohort Actionable In a retrospective study, Avastin (bevacizumab) treatment was associated with increased progression-free survival in cancer patients carrying TP53 mutations (PMID: 23670029). 23670029
TP53 mutant acute myeloid leukemia predicted - sensitive CG-806 Preclinical - Patient cell culture Actionable In a preclinical study, patient-derived acute myeloid leukemia cells harboring TP53 mutations were sensitive to CG-806 in culture (Proceedings of the American Association for Cancer Research, Vol 60, Mar 2019, Abstract #1323). detail...
TP53 mutant medulloblastoma decreased response JQ1 Preclinical Actionable In a preclinical study, medulloblastoma cell lines with TP53 mutations had significantly less sensitivity to the BET inhibitor, JQ1, than cell lines carrying wild-type TP53 (PMID: 24231268). 24231268
TP53 mutant chronic lymphocytic leukemia predicted - sensitive Ibrutinib + Venetoclax Phase II Actionable In a Phase II trial, Imbruvica (ibrutinib) and Venclexta (venetoclax) combination therapy resulted in a response rate of 100% (14/14, 9 complete response, 5 partial response) in relapsed or refractory chronic lymphocytic leukemia (CLL) patients, and a response rate of 100% (16/16, 9 complete response, 7 partial response) in untreated patients with high-risk features including del 17p, TP53 mutations, and del 11q (ASH, 59th Annual Meeting and Exposition, Dec 2017, Abstract 429; NCT02756897). detail...
TP53 mutant medulloblastoma not applicable N/A Guideline Prognostic TP53 mutations are associated with aggressive disease in patients with SHH-activated medulloblastoma (NCCN.org). detail...
TP53 mutant breast cancer sensitive PK11007 Preclinical - Cell culture Actionable In a preclinical study, TP53-mutated breast cancer cell lines demonstrated increased sensitivity to PK11007 compared to TP53-wild type cells in culture, regardless of Esr1 and Erbb2 (Her2) status (J Clin Oncol 35, 2017 (suppl; abstr e14099)). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Methylprednisolone + Obinutuzumab Guideline Actionable Artisone-Wyeth (methylprednisolone) combined with Gazyva (obinutuzumab) is included in guidelines as first-line therapy for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation and for patients with relapsed or refractory disease after prior BTK inhibitor and BLC2 inhibitor-based regimens (NCCN.org). detail...
TP53 mutant acute myeloid leukemia sensitive Decitabine Guideline Actionable Dacogen (decitabine) is included in guidelines for adult patients with acute myeloid leukemia harboring a TP53 mutation (NCCN.org). detail...
TP53 mutant neuroblastoma resistant Nutlin-3a Preclinical Actionable In a preclinical study, neuroblastoma cell lines harboring TP53 mutant were resistant to nutlin-3 mediated growth inhibition (PMID: 21725357). 21725357
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Rituximab + Venetoclax Guideline Actionable Venclexta (venetoclax) combined with Rituxan (rituximab) is included in guidelines as second-line or subsequent therapy (category 1) for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant esophagus adenocarcinoma predicted - sensitive Adavosertib Preclinical - Cell line xenograft Actionable In a preclinical study, Adavosertib (MK-1775) treatment inhibited phosphorylation of Wee1 and Cdk1, and reduced viability of TP53-mutant esophageal adenocarcinoma cells in culture, and led to partial tumor growth delay in cell line xenograft models (PMID: 32220892). 32220892
TP53 mutant head and neck squamous cell carcinoma predicted - sensitive Buparlisib + Paclitaxel Phase II Actionable In a Phase II (BERIL-1) trial, Buparlisib (BKM120) and Taxol (paclitaxel) combination treatment resulted in improved overall survival (HR=0.52) and prolonged progression-free survival (HR=0.45) in head and neck squamous cell carcinoma patients harboring TP53 mutations compared to TP53 wild-type patients (PMID: 29490986; NCT01852292). 29490986
TP53 mutant Advanced Solid Tumor sensitive Pazopanib + Vorinostat Phase I Actionable In a Phase I trial, the combination of Votrient (pazopanib) and Zolinza (vorinostat) improved progression-free survival and overall survival in advanced solid tumor patients harboring TP53 hotspot mutations, and resulted in an increased stable disease rate of 45% (5/11), compared to a stable disease rate of 16% (4/25) in patients without detected TP53 mutations (PMID: 25669829). 25669829
TP53 mutant esophagus adenocarcinoma sensitive Adavosertib + Radiotherapy Preclinical - Cell line xenograft Actionable In a preclinical study, Adavosertib (MK-1775) treatment enhanced sensitivity of TP53-mutant esophageal adenocarcinoma cells to radiation therapy, resulting in inhibition of phosphorylation of Wee1 and Cdk1, reduced colony formation, and increased DNA damage and mitotic cell death in culture, and tumor growth inhibition and regression in cell line xenograft models (PMID: 32220892). 32220892
TP53 mutant glioblastoma sensitive AZD1390 Preclinical - Cell culture Actionable In a preclinical study, TP53 mutant glioblastoma cells demonstrated increased sensitivity to radiosensitization by AZD1390 treatment compared to TP53 wild-type cells in culture (Mol Cancer Ther 2018;17(1 Suppl):Abstract nr A104). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Ibrutinib + Lisocabtagene maraleucel Guideline Actionable Breyanzi (lisocabtagene maraleucel) in combination with Imbruvica (ibrutinib) is included in guidelines for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia sensitive Zanubrutinib Guideline Actionable Brukinsa (zanubrutinib) is included in guidelines as preferred first-line therapy for patients with advanced chronic lymphocytic leukemia harboring TP53 mutations and for patients with relapsed or refractory disease (PMID: 38969011; ESMO.org). detail... 38969011
TP53 mutant chronic lymphocytic leukemia sensitive Venetoclax Guideline Actionable Venclexta (venetoclax) is included in guidelines as first-line therapy for patients with advanced chronic lymphocytic leukemia harboring TP53 mutations and for patients with relapsed or refractory disease (PMID: 38969011; ESMO.org). detail... 38969011
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Ibrutinib + Venetoclax Guideline Actionable Venclexta (venetoclax) combined with Imbruvica (ibrutinib) is included in guidelines as first-line (category 2A) and second-line or subsequent therapy (category 2B) for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia sensitive Ibrutinib Guideline Actionable Imbruvica (ibrutinib) is included in guidelines as preferred first-line therapy for patients with advanced chronic lymphocytic leukemia harboring TP53 mutations and for patients with relapsed or refractory disease (PMID: 38969011; ESMO.org). 38969011 detail...
TP53 mutant triple-receptor negative breast cancer predicted - sensitive Doxorubicin + Seliciclib Preclinical - Cell line xenograft Actionable In a preclinical study, sequential administration of Roscovotine (seliciclib) followed by Adriamycin (doxorubicin) synergistically induced apoptosis in TP53-mutant triple-receptor negative breast cancer cell lines in culture, and inhibited tumor growth, prolonged survival in cell line xenograft models (PMID: 26826118). 26826118
TP53 mutant head and neck squamous cell carcinoma sensitive AZD7762 + Cisplatin Preclinical Actionable In a preclinical study, the treatment of a head and neck squamous cell carcinoma cell line with mutant TP53 (C176F and A161S) with AZD7762, a pan Chk1/2 inhibitor, sensitizes the cells to Platinol (cisplatin) (PMID: 23839309). 23839309
TP53 mutant esophagus squamous cell carcinoma predicted - sensitive Adavosertib Preclinical - Cell culture Actionable In a preclinical study, Adavosertib (MK-1775) treatment inhibited viability of TP53-mutant esophageal squamous cell carcinoma cells in culture (PMID: 32220892). 32220892
TP53 mutant hypopharynx cancer predicted - sensitive unspecified EGFR antibody + unspecified ERBB3 antibody + unspecified IGF-1R antibody Preclinical - Cell culture Actionable In a preclinical study, combination of an unspecified EGFR antibody, an unspecified Erbb3 (Her3) antibody, and an unspecified Igf-1r antibody resulted in potent inhibition of survival in TP53 mutated hypopharyngeal carcinoma cancer cells that developed Erbitux (cetuximab) resistance in culture (PMID: 27196767). 27196767
TP53 mutant ovarian cancer sensitive AZD7648 Preclinical - Pdx Actionable In a preclinical study, AZD7648 treatment inhibited tumor growth in a patient-derived xenograft (PDX) model of ovarian cancer harboring a TP53 mutation and wild-type ATM (PMID: 31699977). 31699977
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma not applicable N/A Guideline Prognostic TP53 mutations are associated with a poor prognosis in patients with chronic lymphocytic leukemia/small lymphocytic lymphoma (NCCN.org). detail...
TP53 mutant hypopharynx cancer resistant unspecified EGFR antibody Preclinical - Cell culture Actionable In a preclinical study, combination of two unspecified EGFR antibodies targeting nonoverlapping epitopes of Egfr did not inhibit proliferation of Tp53 mutated hypopharyngeal carcinoma cells that developed Erbitux (cetuximab) resistance in culture (PMID: 27196767). 27196767
TP53 mutant mantle cell lymphoma sensitive Cyclophosphamide + Cytarabine + Dexamethasone + Doxorubicin + Ibrutinib + Prednisone + Rituximab + Vincristine Sulfate Guideline Actionable The combination of Imbruvica (ibrutinib) plus RCHOP alternating with Rituxan (rituximab), Adexone (dexamethasone), Cytosar-U (cytarabine) plus a platinum is included in guidelines as induction therapy for patients with mantle cell lymphoma harboring a TP53 mutation (NCCN.org). detail...
TP53 mutant ovarian cancer sensitive Etoposide + Nutlin-3a Preclinical Actionable In a preclinical study, Nutlin-3 and etoposide worked cooperatively to induce apoptosis in ovarian cancer cell lines with TP53 inactivating mutations in culture (PMID: 25964101). 25964101
TP53 mutant lung non-small cell carcinoma predicted - sensitive Nivolumab Clinical Study - Cohort Actionable In a clinical study, immune checkpoint inhibitor treatment including Keytruda (pembrolizumab) (n=1), Opdivo (nivolumab) with (n=8) or without (n=63) Yervoy (ipilimumab) resulted in improved median overall survival (18.1 vs 8.1 months, HR=0.48, p=0.04), median progression-free survival (4.5 vs 1.4 months, p=0.03), and objective response rate (51.2% vs 20.7%, p=0.01) in TP53 mutant (n=41) non-small cell lung cancer patients compared to TP53 wild-type (n=31) patients (PMID: 31097096). 31097096
TP53 mutant chronic lymphocytic leukemia sensitive Idelalisib + Rituximab Guideline Actionable Zydelig (idelalisib) and Rituxan (rituximab) combination therapy is included in guidelines as first-line therapy for patients with advanced chronic lymphocytic leukemia harboring TP53 mutations and for patients with relapsed or refractory disease (PMID: 38969011; ESMO.org). detail... 38969011
TP53 mutant Advanced Solid Tumor predicted - sensitive Adavosertib Phase I Actionable In a Phase I trial, Adavosertib (MK-1775) treatment resulted in a prtial response in 3 and progressive disease in 2 of 6 patients with advanced solid tumors harboring TP53 mutations (J Clin Oncol 38: 2020 (suppl; abstr 3624); NCT01748825). detail...
TP53 mutant Advanced Solid Tumor predicted - sensitive Adavosertib Phase I Actionable In a retrospective analysis of a Phase I trial, Adavosertib (MK-1775) combined with a chemotherapy resulted in a 21% (4/19) response rate in advanced solid tumor patients harboring a TP53 mutation and in those without a TP53 mutation, a 12% (4/33) response rate was observed (PMID: 27601554; NCT00648648). 27601554
TP53 mutant breast cancer not applicable N/A Guideline Risk Factor Germline TP53 mutations result in Li-Fraumeni syndrome, which is associated with increased risk of developing breast cancer (NCCN.org). detail...
TP53 mutant neuroblastoma resistant MI-63 Preclinical Actionable In a preclinical study, neuroblastoma cell lines harboring TP53 mutant were resistant to MI-63 mediated growth inhibition (PMID: 21725357). 21725357
TP53 mutant B-cell acute lymphoblastic leukemia not applicable N/A Guideline Prognostic TP53 mutations are associated with poor prognosis in patients with B-cell acute lymphoblastic leukemia (NCCN.org). detail...
TP53 mutant Advanced Solid Tumor sensitive CTX-1 Preclinical Actionable In a preclinical study, CTX-1 induced increased Tp53 protein levels and cell death in human tumor cell lines with mutant Tp53 in culture (PMID: 26883273). 26883273
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Venetoclax Guideline Actionable Venclexta (venetoclax) is included in guidelines as second-line or subsequent therapy for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant acute myeloid leukemia predicted - sensitive Cytarabine + Venetoclax Phase Ib/II Actionable In a Phase I/II trial, Venclexta (venetoclax) in combination with low-dose cytarabine resulted in complete remission or complete remission with incomplete count recovery in 30% (3/10) of patients with acute myeloid leukemia harboring TP53 mutations who were ineligible for intensive chemotherapy (ASH Annual Meeting, Dec 2018, Abstract 284; NCT02287233). detail...
TP53 mutant Advanced Solid Tumor resistant KRT-232 Preclinical - Cell culture Actionable In a preclinical study, KRT-232 (AMG 232) did not inhibit growth of human tumor cell lines harboring TP53 mutations in culture (PMID: 25567130). 25567130
TP53 mutant nephroblastoma not applicable N/A Guideline Risk Factor Germline mutations in TP53 result in Li-Fraumeni syndrome, which is associated with increased risk of developing Wilms tumor (nephroblastoma) (NCCN.org). detail...
TP53 mutant colorectal cancer predicted - sensitive NSC59984 Preclinical - Cell line xenograft Actionable In a preclinical study, NSC59984 treatment resulted in increased Tp53 signaling and cell death in colorectal cancer cell lines harboring TP53 mutations, and inhibited tumor growth in TP53-mutant cell line colorectal cancer xenograft models (PMID: 26294215). 26294215
TP53 mutant acute myeloid leukemia predicted - sensitive Azacitidine + Magrolimab Phase I Actionable In a Phase Ib trial, Magrolimab (Hu5F9-G4) and Vidaza (azacitidine) combination therapy was well tolerated, and resulted in complete response in 42% (5/12), complete response with incomplete hematologic recovery in 33% (4/12), and stable disease in 17% (2/12) of patients with acute myeloid leukemia harboring TP53 mutations and unfit for chemotherapy (J Clin Oncol 38: 2020 (suppl; abstr 7507); NCT03248479). detail...
TP53 mutant hypopharynx cancer predicted - sensitive unspecified EGFR antibody + unspecified ERBB3 antibody Preclinical - Cell culture Actionable In a preclinical study, combination of an unspecified EGFR antibody and an unspecified Erbb3 (Her3) antibody resulted in inhibition of survival in TP53 mutated hypopharyngeal carcinoma cancer cells that developed Erbitux (cetuximab) resistance in culture (PMID: 27196767). 27196767
TP53 mutant ovarian cancer predicted - sensitive AZD7648 + Olaparib Preclinical - Pdx Actionable In a preclinical study, AZD7648 and Lynparza (olaparib) combination treatment induced tumor regression in a patient-derived xenograft (PDX) model of ovarian cancer harboring TP53 mutation and wild-type ATM (PMID: 31699977). 31699977
TP53 mutant glioblastoma sensitive Adavosertib + Radiotherapy Preclinical - Cell line xenograft Actionable In a preclinical study, the combination of Adavosertib (MK-1775) and radiation therapy synergized to inhibit tumor growth in a human glioblastoma multiforme cell line xenograft model harboring mutant TP53 (PMID: 21992793). 21992793
TP53 mutant fibrous histiocytoma predicted - sensitive GDC-0575 + Gemcitabine Preclinical - Pdx Actionable In a preclinical study, GDC-0575 and Gemzar (gemcitabine) combination treatment inhibited tumor growth, prolonged progression-free survival in patient-derived xenograft (PDX) models of undifferentiated pleomorphic sarcoma (fibrous histiocytoma) (PMID: 29409053). 29409053
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Obinutuzumab Guideline Actionable Gazyva (obinutuzumab) is included in guidelines as first-line therapy for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant colorectal cancer sensitive Prodigiosin Preclinical - Cell line xenograft Actionable In a preclinical study, Prodigiosin inhibited self-renewal of colorectal cancer cell lines harboring TP53 mutations in culture and suppressed tumor growth in cell line xenograft models (PMID: 26759239). 26759239
TP53 mutant sarcoma predicted - sensitive GDC-0575 + Gemcitabine Phase I Actionable In a Phase I trial, GDC-0575 and Gemzar (gemcitabine) combination treatment resulted in a prolonged tumor response in 2 soft tissue sarcoma patients harboring TP53 mutations, and no response in a patient with TP53 wild-type tumor (PMID: 29409053; NCT01564251). 29409053
TP53 mutant skin melanoma not applicable N/A Guideline Risk Factor Germline TP53 mutations or polymorphisms are associated with increased risk of developing single or multiple primary cutaneous melanomas (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia predicted - sensitive CG-806 Case Reports/Case Series Actionable In a Phase I trial, CG-806 treatment was well-tolerated, and a patient with chronic lymphocytic leukemia harboring a TP53 mutation stayed on treatment for more than 8 cycles (25th Annual Congress of EHA (Jun 2020), Abstract EP711; NCT03893682). detail...
TP53 mutant leukemia decreased response RG7112 Phase I Actionable In a Phase I clinical trial, the majority of 19 leukemia patients with identified TP53 mutations did not demonstrate response to treatment with RG7112, with 2 acute myeloid leukemia patients harboring TP53 mutations showing clinical activity, but not improvement, and 1 sCLL/CLL patient achieving stable disease (PMID: 26459177). 26459177
TP53 mutant mantle cell lymphoma sensitive Obinutuzumab + Venetoclax + Zanubrutinib Guideline Actionable The combination of Brukinsa (zanubrutinib), Gazyva (obinutuzumab), and Venclexta (venetoclax) is included in guidelines as induction therapy for patients with mantle cell lymphoma harboring a TP53 mutation (NCCN.org). detail...
TP53 mutant osteosarcoma not applicable N/A Guideline Risk Factor Germline mutations in TP53 result in Li-Fraumeni syndrome, which is associated with increased risk of developing osteosarcoma (NCCN.org). detail...
TP53 mutant ovarian serous carcinoma sensitive thioureidobutyronitrile Preclinical - Cell culture Actionable In a preclinical study, Kevetrin (thioureidobutyronitrile) treatment decreased mutant Tp53 level, resulted in apoptosis of ovarian serous carcinoma cells harboring TP53 mutations in culture (Proceedings of the AACR, Vol 58, Apr 2017, abstract # 3221). detail...
TP53 mutant chronic lymphocytic leukemia predicted - sensitive Duvelisib Phase I Actionable In a Phase I trial, Copiktra (duvelisib) treatment inhibited Akt phosphorylation, resulted in complete response in 2% (1/49), partial response in 53% (26/49), and stable disease in 43% (21/49) of chronic lymphocytic leukemia patients, of which 49% (23/47) carried TP53 mutations (Blood 124 (21): 3334). detail...
TP53 mutant adrenocortical carcinoma not applicable N/A Guideline Risk Factor Germline TP53 mutations result in Li-Fraumeni syndrome, which is associated with increased risk of developing adrenocortical carcinoma (NCCN.org). detail...
TP53 mutant mantle cell lymphoma sensitive Acalabrutinib + Cyclophosphamide + Cytarabine + Dexamethasone + Doxorubicin + Prednisone + Rituximab + Vincristine Sulfate Guideline Actionable The combination of Calquence (acalabrutinib) plus RCHOP alternating with Rituxan (rituximab), Adexone (dexamethasone), Cytosar-U (cytarabine) plus a platinum is included in guidelines as induction therapy for patients with mantle cell lymphoma harboring a TP53 mutation (NCCN.org). detail...
TP53 mutant mantle cell lymphoma sensitive Acalabrutinib + Rituximab Guideline Actionable The combination of Calquence (acalabrutinib) and Rituxan (rituximab) is included in guidelines as induction therapy for patients with mantle cell lymphoma harboring a TP53 mutation (NCCN.org). detail...
TP53 mutant triple-receptor negative breast cancer predicted - sensitive GDC-0425 + Gemcitabine Phase I Actionable In a Phase I trial, treatment with GDC-0425 followed by Gemzar (gemcitabine) resulted in a partial response in a patient with triple-receptor negative breast cancer harboring a TP53 mutation (PMID: 27815358). 27815358
TP53 mutant pharynx squamous cell carcinoma sensitive Ceralasertib + Radiotherapy Preclinical - Cell culture Actionable In a preclinical study, AZD6738 treatment increased sensitivity to radiotherapy in a pharynx squamous cell carcinoma cell line harboring a TP53 mutation in culture, resulting in a greater decrease in cell survival compared to radiation treatment alone (PMID: 28062704). 28062704
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Methylprednisolone + Rituximab Guideline Actionable Artisone-Wyeth (methylprednisolone) combined with Rituxan (rituximab) is included in guidelines as first-line therapy for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation and for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 mutant esophagus squamous cell carcinoma sensitive Adavosertib + Radiotherapy Preclinical - Cell culture Actionable In a preclinical study, Adavosertib (MK-1775) treatment enhanced sensitivity of TP53-mutant esophageal squamous cell carcinoma cells to radiation therapy, resulting in decreased colony formation in culture (PMID: 32220892). 32220892
TP53 mutant mantle cell lymphoma sensitive Cyclophosphamide + Cytarabine + Dexamethasone + Doxorubicin + Prednisone + Rituximab + Vincristine Sulfate + Zanubrutinib Guideline Actionable The combination of Brukinsa (zanubrutinib) plus RCHOP alternating with Rituxan (rituximab), Adexone (dexamethasone), Cytosar-U (cytarabine) plus a platinum is included in guidelines as induction therapy for patients with mantle cell lymphoma harboring a TP53 mutation (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Idelalisib Guideline Actionable Zydelig (idelalisib) is included in the guidelines for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Venetoclax + Zanubrutinib Guideline Actionable Venclexta (venetoclax) combined with Brukinsa (zanubrutinib) is included in guidelines as first-line therapy for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant high grade glioma no benefit AZ31 + Radiotherapy Preclinical Actionable In a preclinical study, AZ31 treatment increased sensitivity to radiotherapy in TP53-mutant mouse glioma cells in culture, but failed to radiosensitize tumors in syngeneic mouse models due to poor blood-brain barrier permeability (PMID: 29769307). 29769307
TP53 mutant ovarian cancer no benefit Nutlin-3a Preclinical Actionable In a preclinical study, treatment with Nutlin-3 had little effect on growth of ovarian cancer cells with TP53 mutations in culture (PMID: 25964101). 25964101
TP53 mutant sarcoma sensitive Pazopanib Clinical Study - Cohort Actionable In a retrospective analysis, advanced sarcoma patients with TP53 mutations displayed improved progression-free survival (208 vs 136 days, p=0.036) relative to patients with wild-type TP53 when treated with Votrient (pazopanib) (PMID: 26646755). 26646755
TP53 mutant chronic lymphocytic leukemia sensitive Obinutuzumab + Venetoclax Guideline Actionable Venclexta (venetoclax) and Gazyva (obinutuzumab) combination therapy is included in guidelines as first-line therapy for patients with advanced chronic lymphocytic leukemia harboring TP53 mutations and for patients with relapsed or refractory disease (PMID: 38969011; ESMO.org). 38969011 detail...
TP53 mutant acute myeloid leukemia not applicable N/A Guideline Prognostic TP53 mutations are associated with a poor/adverse prognosis in patients with non-APL acute myeloid leukemia (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Lisocabtagene maraleucel Guideline Actionable Breyanzi (lisocabtagene maraleucel) is included in guidelines for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 mutant endometrial carcinoma predicted - sensitive Adavosertib Case Reports/Case Series Actionable In a Phase I trial, Adavosertib (MK-1775) treatment resulted in a partial response (PR) in 17% (6/35) of patients with advanced solid tumors, 2 of the patients achieved PR had endometrial carcinoma (EC), and TP53 mutations were identified in 1 of the EC patients with biopsy available for genomic analysis (J Clin Oncol 38: 2020 (suppl; abstr 3624); NCT01748825). detail...
TP53 mutant ovarian carcinoma predicted - sensitive Adavosertib Case Reports/Case Series Actionable In a Phase I trial, Adavosertib (MK-1775) treatment resulted in a partial response (PR) in 17% (6/35) of patients with advanced solid tumors, 4 of the patients achieved PR had ovarian carcinoma (OVC), and TP53 mutations were identified in 2 of the OVC patients with biopsies available for genomic analysis (J Clin Oncol 38: 2020 (suppl; abstr 3624); NCT01748825). detail...
TP53 mutant Advanced Solid Tumor sensitive unspecified VEGFR inhibitor Clinical Study - Cohort Actionable In a clinical study, VEGF/VEGFR inhibitor treatment resulted in improved rates of response (stable disease over 6 months/partial/complete response, 31% vs 7%), time-to-treatment failure, and overall survival (both p<0.01) compared to control in patients with TP53 mutant advanced solid tumors (n=106), but not in patients with TP53 wild-type tumors (n=82) (PMID: 27466356). 27466356
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Ibrutinib Guideline Actionable Imbruvica (ibrutinib) is included in guidelines as first-line therapy (category 2A) and second-line or subsequent therapy (category 1) for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Alemtuzumab + Rituximab Guideline Actionable Campath (alemtuzumab) combined with Rituxan (rituximab) is included in guidelines for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 mutant ovarian cancer predicted - sensitive Olaparib Preclinical - Pdx Actionable In a preclinical study, Lynparza (olaparib) treatment inhibited tumor growth but did not induce regression in a patient-derived xenograft (PDX) model of ovarian cancer harboring wild-type ATM and TP53 mutation (PMID: 31699977). 31699977
TP53 mutant colon carcinoma predicted - sensitive Camptothecin + CHIR-124 Preclinical - Cell culture Actionable In a preclinical study, the combination of Camptothecin and CHIR-124 demonstrated synergy in TP53-mutant colon carcinoma cell lines in culture, resulting in increased growth inhibition (PMID: 17255282). 17255282
TP53 mutant breast carcinoma predicted - sensitive Camptothecin + CHIR-124 Preclinical - Cell culture Actionable In a preclinical study, the combination of Camptothecin and CHIR-124 demonstrated synergy in TP53-mutant breast carcinoma cell lines in culture, resulting in increased growth inhibition (PMID: 17255282). 17255282
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Acalabrutinib + Obinutuzumab Guideline Actionable Calquence (acalabrutinib) combined with Gazyva (obinutuzumab) is included in guidelines as first-line therapy for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant ovarian cancer predicted - sensitive Adavosertib + Carboplatin Phase II Actionable In a Phase II trial, Paraplatin (carboplatin) and Adavosertib (MK-1775) combination treatment resulted in an overall response rate of 43% (9/21), a median progression-free survival of 5.3 months and a median overall survival of 12.6 months in ovarian cancer patients harboring TP53 mutations (PMID: 27998224; NCT01164995). 27998224
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma predicted - sensitive Zanubrutinib Phase I Actionable In a Phase I trial, Brukinsa (zanubrutinib) treatment resulted in an overall response rate of 100% (16/16) in patients with CLL/SLL harboring del (17p) or TP53 mutations (PMID: 31340982; NCT02343120). 31340982
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma predicted - sensitive Zanubrutinib Guideline Actionable Brukinsa (zanubrutinib) is included in guidelines as first-line therapy (category 2A) and second line therapy or subsequent therapy (category 1) for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Acalabrutinib Guideline Actionable Calquence (acalabrutinib) is included in guidelines as first-line (category 2A) and second-line or subsequent therapy (category 1) for chronic lymphocytic leukemia/small lymphocytic lymphoma patients with a TP53 mutation (NCCN.org). detail...
TP53 mutant lung non-small cell carcinoma sensitive CEP-8983 + Cisplatin Preclinical Actionable In a preclinical study, the combination of CEP-8983 and Platinol (cisplatin) worked synergistically to induce cell death in non-small cell lung cancer cell lines in culture, irrespective of TP53 status (PMID: 23428903). 23428903
TP53 mutant lung non-small cell carcinoma predicted - sensitive Ipilimumab + Nivolumab Clinical Study - Cohort Actionable In a clinical study, immune checkpoint inhibitor treatment including Keytruda (pembrolizumab) (n=1), Opdivo (nivolumab) with (n=8) or without (n=63) Yervoy (ipilimumab) resulted in improved median overall survival (18.1 vs 8.1 months, HR=0.48, p=0.04), median progression-free survival (4.5 vs 1.4 months, p=0.03), and objective response rate (51.2% vs 20.7%, p=0.01) in TP53 mutant (n=41) non-small cell lung cancer patients compared to TP53 wild-type (n=31) patients (PMID: 31097096). 31097096
TP53 mutant sarcoma sensitive Pazopanib + Vorinostat Phase I Actionable In a Phase I trial, the combination of Votrient (pazopanib) and Zolinza (vorinostat) resulted in improved progression-free survival and overall survival in metastatic sarcoma and colorectal cancer patients harboring TP53 hotspot mutations, and resulted in a stable disease rate of 83% (5/6), compared to a stable disease rate of 9% (1/11) in patients without detected TP53 mutations (PMID: 25669829). 25669829
TP53 mutant colorectal cancer sensitive Pazopanib + Vorinostat Phase I Actionable In a Phase I trial, the combination of Votrient (pazopanib) and Zolinza (vorinostat) resulted in improved progression-free survival and overall survival in metastatic sarcoma and colorectal cancer patients harboring TP53 hotspot mutations, and resulted in a stable disease rate of 83% (5/6), compared to a stable disease rate of 9% (1/11) in patients without detected TP53 mutations (PMID: 25669829). 25669829
TP53 mutant essential thrombocythemia not applicable N/A Guideline Prognostic TP53 mutations are associated with inferior leukemia-free survival in patients with essential thrombocythemia (NCCN.org). detail...
TP53 mutant essential thrombocythemia not applicable N/A Guideline Prognostic The presence of at least one mutation in either SH2B3, IDH2, U2AF1, SRSF2, SF3B1, EZH2, TP53, or RUNX1 is associated with inferior overall survival in patients with essential thrombocythemia (NCCN.org). detail...
TP53 mutant chronic lymphocytic leukemia/small lymphocytic lymphoma sensitive Idelalisib + Rituximab Guideline Actionable Zydelig (idelalisib) combined with Rituxan (rituximab) is included in guidelines for patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma with a TP53 mutation after prior BTK inhibitor-based and BCL2 inhibitor-containing regimens (NCCN.org). detail...
TP53 inact mut breast carcinoma predicted - sensitive CHIR-124 + SN-38 Preclinical - Cell culture Actionable In a preclinical study, SN-38 and CHIR-124 demonstrated synergy in a breast carcinoma cell line with defective TP53, resulting in increased cell cycle arrest and apoptosis in culture (PMID: 17255282). 17255282
TP53 inact mut prostate cancer no benefit Enzalutamide Clinical Study - Cohort Actionable In a clinical study, treatment with either Xtandi (enzalutamide) or Zytiga (abiraterone) in patients with metastatic castration-resistant prostate cancer harboring a TP53 inactivating mutation, detected via circulating tumor cells, demonstrated a shorter progression-free survival (3.0 vs 8.7mo; P<0.0001) and overall survival (7.8 vs 26.7mo; P<0.0001) and fewer patients with a PSA response greater than or equal to 50% (15.4 vs 46.8%; P=0.008) compared to those patients with wild-type TP53 (PMID: 30209161). 30209161
TP53 inact mut ovarian cancer sensitive Adavosertib + Carboplatin + Paclitaxel Phase II Actionable In a Phase II trial, treatment with Adavosertib (MK-1775) plus Paraplatin (carboplatin) and Taxol (paclitaxel) resulted in an improved progression-free survival by enhanced RECIST of 7.9 mo vs. 7.3 mo with placebo plus chemotherapy, and complete response in 11/9% (7/59) vs. 8.9% (5/62), partial response in 62.7% (37/59) vs. 61.3% (38/62), and stable disease in 5.1% (3/59) vs. 4.8% (3/62) of patients with platinum-sensitive ovarian cancer harboring an inactivating TP53 mutation (PMID: 32611648; NCT01357161). 32611648
TP53 inact mut ovarian cancer sensitive Cisplatin + Nutlin-3a Preclinical Actionable In a preclinical study, Nutlin-3 and cisplatin worked cooperatively to induce apoptosis in ovarian cancer cell lines with TP53 inactivating mutations in culture (PMID: 25964101). 25964101
TP53 inact mut breast cancer sensitive AMG 900 Preclinical Actionable In a preclinical study, breast cancer cell lines with TP53 loss of function mutations had more pronounced apoptosis after treatment with AMG 900 in culture (PMID: 24091768). 24091768
TP53 inact mut lung small cell carcinoma sensitive APR-246 Preclinical - Cell line xenograft Actionable In a preclinical study, APR-246 induced apoptosis in small-cell lung cancer (SCLC) cell lines and decreased tumor growth in SCLC cell line xenograft models harboring Tp53 inactivating mutations (PMID: 21415220). 21415220
TP53 inact mut lung non-small cell carcinoma not predictive Osimertinib Clinical Study - Cohort Actionable In a retrospective analysis, patients with non-small cell lung cancer harboring inactivating TP53 mutations at treatment discontinuation of Tagrisso (osimertinib) had shorter time to treatment discontinuation (5 vs 11.5 months, p=0.0005) compared to patients with wild-type TP53 (PMID: 31839416). 31839416
TP53 inact mut breast carcinoma predicted - sensitive CHIR-124 + Irinotecan Preclinical - Cell line xenograft Actionable In a preclinical study, sequential treatment with Camptosaur (irinotecan) and CHIR-124 enhanced tumor growth inhibition compared to either agent alone in a breast carcinoma cell line xenograft model with defective TP53 (PMID: 17255282). 17255282
TP53 inact mut chronic lymphocytic leukemia sensitive Ceralasertib + Ibrutinib Preclinical Actionable In a preclinical study, AZD6738 sensitized TP53-deficient chronic lymphocytic leukemia cells to Imbruvica (Ibrutinib) treatment in culture (PMID: 26563132). 26563132
TP53 inact mut chronic lymphocytic leukemia predicted - sensitive AZD6482 Preclinical Actionable In a preclinical study, AZD6482 induced cell death in TP53-deficient chronic lymphocytic leukemia cells in culture and inhibited tumor growth in xenograft models (PMID: 26563132). 26563132
TP53 inact mut ovarian carcinoma sensitive ReACp53 Preclinical Actionable In a preclinical study, ReACp53 induced cell death and decreased proliferation of ovarian carcinoma cells harboring TP53 mutations in culture, but did not effect viability of ovarian carcinoma cells with wild-type TP53 (PMID: 26748848). 26748848
TP53 inact mut ovarian cancer sensitive Cisplatin + LB-100 Preclinical Actionable In a preclinical study, LB100 treatment decreased PP2A activity and increased sensitivity to Platinol (cisplatin) in a cisplatin-resistant ovarian cancer cell line harboring a TP53 inactivating mutation in culture (PMID: 25376608). 25376608
TP53 inact mut breast cancer sensitive Adavosertib + Radiotherapy Preclinical Actionable In a preclinical study, Adavosertib (MK-1775) increased the efficacy of radiation in breast cancer cells with defective TP53 in culture (PMID: 21799033). 21799033
TP53 inact mut prostate cancer no benefit Abiraterone Clinical Study - Cohort Actionable In a clinical study, treatment with either Xtandi (enzalutamide) or Zytiga (abiraterone) in patients with metastatic castration-resistant prostate cancer harboring a TP53 inactivating mutation, detected via circulating tumor cells, demonstrated a shorter progression-free survival (3.0 vs 8.7mo; P<0.0001) and overall survival (7.8 vs 26.7mo; P<0.0001) and fewer patients with a PSA response greater than or equal to 50% (15.4 vs 46.8%; P=0.008) compared to those patients with wild-type TP53 (PMID: 30209161). 30209161